Details of the Drug
General Information of Drug (ID: DM2QBHP)
Drug Name |
Eteplirsen
|
||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Synonyms | AVI-4658 | ||||||||||||||||||||||
Indication |
|
||||||||||||||||||||||
Drug Type |
Antisense drug
|
||||||||||||||||||||||
Sequence |
CUCCAACAUCAAGGAAGAUGGCAUUUCUAG
|
||||||||||||||||||||||
Structure | 3D Structure is Not Available | ||||||||||||||||||||||
3D MOL is unavailable | 2D MOL | ||||||||||||||||||||||
ADMET Property |
|
||||||||||||||||||||||
Cross-matching ID | |||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
The Studied Disease | Duchenne dystrophy | |||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ICD Disease Classification | 8C70 | |||||||||||||||||||||||
|
||||||||||||||||||||||||
Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||