Details of the Drug
General Information of Drug (ID: DM5Q12D)
Drug Name |
ISIS 13740
|
|||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Indication |
|
|||||||||||||||||||
Drug Type |
Antisense drug
|
|||||||||||||||||||
Sequence |
TGGATGGGTGTTTTTGGAGA
|
|||||||||||||||||||
Cross-matching ID | ||||||||||||||||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
The Studied Disease | Discovery agent | |||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ICD Disease Classification | N.A. | |||||||||||||||||||||||
|
||||||||||||||||||||||||
Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||
References