Details of the Drug

General Information of Drug (ID: DMA3ZGH)

Drug Name

ISIS 107773

Indication

Disease Entry	ICD 11	Status	REF
Discovery agent	N.A.	Investigative	[1]

Drug Type

Antisense drug

Sequence

CTGGCTTCATGTCGGATATC

Cross-matching ID

Molecular Interaction Atlas of This Drug

Drug Therapeutic Target (DTT)

Molecular Interaction Atlas (MIA)

Jump to Detail Molecular Interaction Atlas of This Drug

Molecular Expression Atlas of This Drug

The Studied Disease

Discovery agent

ICD Disease Classification

N.A.

Molecule Name	Molecule Type	Gene Name	p-value	Fold-Change	Z-score
PTPN1 messenger RNA (PTPN1 mRNA)	DTT	PTPN1	9.44E-01	7.21E-03	0.08

Molecular Expression Atlas (MEA)

Jump to Detail Molecular Expression Atlas of This Drug

References

1	US patent application no. 6,261,840, Antisense modulation of PTP1B expression.
2	Periodinates: a new class of protein tyrosine phosphatase inhibitors. Bioorg Med Chem Lett. 1999 Feb 8;9(3):353-6.
3	Evans Blue and other dyes as protein tyrosine phosphatase inhibitors. Bioorg Med Chem Lett. 2004 Apr 19;14(8):1923-6.
4	Cytotoxic and PTP1B inhibitory activities from Erythrina abyssinica. Bioorg Med Chem Lett. 2009 Dec 1;19(23):6745-9.
5	Clinical pipeline report, company report or official report of ISIS Pharmaceuticals (2009).
6	Clinical pipeline report, company report or official report of ISIS Pharmaceuticals.
7	2-O-carboxymethylpyrogallol derivatives as PTP1B inhibitors with antihyperglycemic activity. Bioorg Med Chem Lett. 2007 Oct 1;17(19):5357-60.
8	How many drug targets are there Nat Rev Drug Discov. 2006 Dec;5(12):993-6.