Details of the Drug

General Information of Drug (ID: DMND0JL)

Drug Name

ISIS 12883

Indication

Disease Entry	ICD 11	Status	REF
Discovery agent	N.A.	Investigative	[1]

Drug Type

Antisense drug

Sequence

GTCCCCACCGCCACTCCTGG

Cross-matching ID

Molecular Interaction Atlas of This Drug

Drug Therapeutic Target (DTT)

Molecular Interaction Atlas (MIA)

Jump to Detail Molecular Interaction Atlas of This Drug

Molecular Expression Atlas of This Drug

The Studied Disease

Discovery agent

ICD Disease Classification

N.A.

Molecule Name	Molecule Type	Gene Name	p-value	Fold-Change	Z-score
ERBB2 messenger RNA (HER2 mRNA)	DTT	ERBB2	3.50E-77	0.49	1.12

Molecular Expression Atlas (MEA)

Jump to Detail Molecular Expression Atlas of This Drug

References

1	US patent application no. 5,968,748, Antisense oligonucleotide modulation of human HER-2 expression.
2	Identification of genotype-correlated sensitivity to selective kinase inhibitors by using high-throughput tumor cell line profiling. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19936-41.
3	Preclinical pharmacokinetics and in vitro metabolism of BMS-690514, a potent inhibitor of EGFR and VEGFR2. J Pharm Sci. 2010 Aug;99(8):3579-93.
4	Design, synthesis, and biological evaluation of 3,4-diarylmaleimides as angiogenesis inhibitors. J Med Chem. 2006 Feb 23;49(4):1271-81.
5	Discovery of a (1H-benzoimidazol-2-yl)-1H-pyridin-2-one (BMS-536924) inhibitor of insulin-like growth factor I receptor kinase with in vivo antitum... J Med Chem. 2005 Sep 8;48(18):5639-43.
6	Discovery of a series of 2,5-diaminopyrimidine covalent irreversible inhibitors of Bruton's tyrosine kinase with in vivo antitumor activity. J Med Chem. 2014 Jun 26;57(12):5112-28.
7	Synthesis and evaluation of geldanamycin-estradiol hybrids. Bioorg Med Chem Lett. 1999 May 3;9(9):1233-8.
8	Tyrosine kinase inhibitors. 19. 6-Alkynamides of 4-anilinoquinazolines and 4-anilinopyrido[3,4-d]pyrimidines as irreversible inhibitors of the erbB... J Med Chem. 2006 Feb 23;49(4):1475-85.