Details of the Drug
General Information of Drug (ID: DM1NHJ8)
| Drug Name |
ISIS 112000
|
||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Indication |
|
||||||||||||||||||||||
| Drug Type |
Antisense drug
|
||||||||||||||||||||||
| Sequence |
AGACTCTGACTTAGACATGA
|
||||||||||||||||||||||
| Cross-matching ID | |||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||

