Details of the Drug
General Information of Drug (ID: DM2QBHP)
| Drug Name |
Eteplirsen
|
||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Synonyms | AVI-4658 | ||||||||||||||||||||||
| Indication |
|
||||||||||||||||||||||
| ATC Code | |||||||||||||||||||||||
| Drug Type |
Antisense drug
|
||||||||||||||||||||||
| Sequence |
CUCCAACAUCAAGGAAGAUGGCAUUUCUAG
|
||||||||||||||||||||||
| Structure | 3D Structure is Not Available |
![]() |
|||||||||||||||||||||
| 3D MOL is unavailable | 2D MOL | ||||||||||||||||||||||
| ADMET Property |
|
||||||||||||||||||||||
| Cross-matching ID | |||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
| The Studied Disease | Duchenne dystrophy | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ICD Disease Classification | 8C70 | |||||||||||||||||||||||
|
||||||||||||||||||||||||
| Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||


