Details of the Drug
General Information of Drug (ID: DMBWCZR)
| Drug Name |
ISIS 107612
|
||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Indication |
|
||||||||||||||||||||||
| Drug Type |
Antisense drug
|
||||||||||||||||||||||
| Sequence |
CTGCTCAGACAGCAGATGCT
|
||||||||||||||||||||||
| Cross-matching ID | |||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
| The Studied Disease | Discovery agent | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ICD Disease Classification | N.A. | |||||||||||||||||||||||
|
||||||||||||||||||||||||
| Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||

