Details of the Drug
General Information of Drug (ID: DMTQRVC)
| Drug Name |
PMID27376512-Compound-asCEBP-1
|
|||||
|---|---|---|---|---|---|---|
| Drug Type |
Nucleotide
|
|||||
| Sequence |
CCGGGACGCAGGCGGCGUCAGGC
|
|||||
| Cross-matching ID | ||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
|
||||||||||||||||||||||||||||||
| Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|

