Details of the Drug
General Information of Drug (ID: DMUVON0)
| Drug Name |
PNT-2258
|
||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Indication |
|
||||||||||||||||||||||||||
| Drug Type |
Antisense drug
|
||||||||||||||||||||||||||
| Sequence |
CACGCACGCGCATCCCCGCCCGTG
|
||||||||||||||||||||||||||
| Cross-matching ID | |||||||||||||||||||||||||||
| Repurposed Drugs (RPD) | Click to Jump to the Detailed RPD Information of This Drug | ||||||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
| The Studied Disease | Diffuse large B-cell lymphoma | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ICD Disease Classification | 2A81 | |||||||||||||||||||||||
|
||||||||||||||||||||||||
| Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||
References

