Details of the Drug
General Information of Drug (ID: DMUVON0)
Drug Name |
PNT-2258
|
||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Indication |
|
||||||||||||||||||||||||||
Drug Type |
Antisense drug
|
||||||||||||||||||||||||||
Sequence |
CACGCACGCGCATCCCCGCCCGTG
|
||||||||||||||||||||||||||
Cross-matching ID | |||||||||||||||||||||||||||
Repurposed Drugs (RPD) | Click to Jump to the Detailed RPD Information of This Drug | ||||||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
![]() Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
The Studied Disease | Diffuse large B-cell lymphoma | |||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ICD Disease Classification | 2A81 | |||||||||||||||||||||||
|
||||||||||||||||||||||||
Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||
References