Details of the Drug
General Information of Drug (ID: DMGTBC7)
Drug Name |
ISIS 2922
|
||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Synonyms | Formivirsen sodium; 5'-d[G*C*G*T*T*T*G*C*T*C*T*T*C*T*T*C*T*T*G*C*G*]-3'; 5-SpG SpC SpG SpT spT SpT spG spC spT spC spT spT spC spT spT spC spT spT spG spC spG-3' | ||||||||||||||||||||||
Indication |
|
||||||||||||||||||||||
Drug Type |
Antisense drug
|
||||||||||||||||||||||
Sequence |
GCGTTTGCTCTTCTTCTTGCG
|
||||||||||||||||||||||
Cross-matching ID | |||||||||||||||||||||||
Combinatorial Drugs (CBD) | Click to Jump to the Detailed CBD Information of This Drug | ||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||