Details of the Drug
General Information of Drug (ID: DMRHSY6)
Drug Name |
ISIS 140161
|
||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Indication |
|
||||||||||||||||||||||
Drug Type |
Antisense drug
|
||||||||||||||||||||||
Sequence |
GTCATGGACCACCACGTTCC
|
||||||||||||||||||||||
Cross-matching ID | |||||||||||||||||||||||
Molecular Interaction Atlas of This Drug
Drug Therapeutic Target (DTT) |
|
||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular Interaction Atlas (MIA) | |||||||||||||||||||||||||||
Molecular Expression Atlas of This Drug
The Studied Disease | Discovery agent | |||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ICD Disease Classification | N.A. | |||||||||||||||||||||||
|
||||||||||||||||||||||||
Molecular Expression Atlas (MEA) | ||||||||||||||||||||||||