Details of the Drug

General Information of Drug (ID: DMEBQAO)

Drug Name

Lumasiran

Indication

Disease Entry	ICD 11	Status	REF
Hyperoxaluria	5C51.2	Approved	[1]
------------------------------------------------------------------------------------

Drug Type

Small interfering RNA

Sequence

>Subunit 1
GACUUUCAUCCUGGAAAUAUAX
>Subunit 2
UAUAUUUCCAGGAUGAAAGUCCA

ADMET Property

Absorption AUC: The area under the plot of plasma concentration (AUC) of drug is 7400 mcgh/L [2]
Absorption Cmax: The maximum plasma concentration (Cmax) of drug is 529 mcg/L [2]
Absorption Tmax: The time to maximum plasma concentration (Tmax) is 4 h [2]
Clearance: The renal clearance of drug is 2.0-3.4 L/h [2]
Elimination: 7-26% of a dose of lumasiran is recovered in the urine as the unmetabolized parent compound [2]
Half-life: The concentration or amount of drug in body reduced by one-half in 5.2 hours [2]
Metabolism: The drug is metabolized via the endonucleases and exonucleases [2]
Vd: The volume of distribution (Vd) of drug is 4.9 L [2]

Cross-matching ID

Molecular Interaction Atlas of This Drug

Drug Therapeutic Target (DTT)

Molecular Interaction Atlas (MIA)

Jump to Detail Molecular Interaction Atlas of This Drug

References

1	Drugs@FDA. U.S. Food and Drug Administration. U.S. Department of Health Human Services. 2020
2	EMA Summary of Product Characteristics: Oxlumo (Lumasiran) Subcutaneous Injection